lop3052 lop3052
  • 02-04-2017
  • History
contestada

Oil and coal are forms of what energy

Respuesta :

ilikepizzza414 ilikepizzza414
  • 02-04-2017
Fossil Fuels - Coal, Oil and Natural Gas. There are three major forms of fossil fuels: coal, oil and natural gas. All three were formed many hundreds of millions of years ago before the time of the dinosaurs – hence the name fossil fuels.

Answer Link

Otras preguntas

Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
why is the square root of a perfect square always rational
What property is shown by the equation? 1. 0 ÷ (–6) = 0
Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
the perimeter of a square 116ft ?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?
Where did middle names come from
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The