n6anmedgDoriang n6anmedgDoriang
  • 01-04-2017
  • Mathematics
contestada

Solve the quadratic equation.

(x + 3)2 = 64
A) x = 5 or -11
B) x = 11 or -5
C) x = ± 3
D) x = ± 11

Respuesta :

Luv2Teach
Luv2Teach Luv2Teach
  • 05-04-2017
The answer is A. You start by "undoing" the square on the left by taking the square root of both sides, which gives you, simplified version here, x+3=+/-8. Move the 3 over by subtraction to get 2 different values for x now: x=8-3 which is 5, or x= -8-3 which is -11.
Answer Link

Otras preguntas

Simplify using the distributive property: 6(y-8) = Oy - 48 O by - 48 O by - 8 6y + 48
how did the spread of homo-sapiens from Africa to other continents likely influence populations of other organisms
Somebody please help me!!!again
i need a little help i dont understand this question
If you were tasked with creating a social media campaign to bring awareness to the atrocities committed in the Congo what three hashtags would you use? I NEED A
Write a function in any form that would match the graph shown below. PLEASE HELP
In a department store a desk costs £120. In a sale the price in reduced by 10%. How much is the desk reduced by
A recipe for slime calls for 1/2 cup water and 1/4 cup glue. what is the total amount of liquid need to the recipe?​
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
Can a triangle have three acute angles? Justify your answer