rieffell31
rieffell31 rieffell31
  • 02-02-2022
  • Mathematics
contestada

what is 685 x 32?? im confused

Respuesta :

serenitybla
serenitybla serenitybla
  • 02-02-2022

Answer:

21920

Step-by-step explanation:

Answer Link
BellaIsMe10
BellaIsMe10 BellaIsMe10
  • 02-02-2022

Answer:

21,920

Step-by-step explanation:

Work uploaded below :)

Ver imagen BellaIsMe10
Answer Link

Otras preguntas

You have passed all your tests. You ____ be very pleased with yourself.mustn'tshouldmustshouldn't​
I ______ gotten to the hotel two hours ago, but my flight was delayed. should have should should of
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
Bob is a researcher in the Health and Human Performance Department. One day he was sitting at the park and noticed that birds preferred to hop when moving on th
13530 grams is equal to how many kilograms
33) What, to the American slave, is your 4th of July? I answer: a day that reveals to him, more than all other days in the year, the gross injustice and cruelty
match the correct y=mx+b equation to the graph: pls show work/explanation!
Describe an example of symbolism you witnessed in the Concord City election or recent news.
what changes in color occur when bromine reacts with an alkene​
For several years, CSK Auto, Inc., fraudulently reported inflated earnings. During this period, Maynard Jenkins was CEO. He was not involved in the fraud, howev