bris72206 bris72206

04-03-2021
History

contestada

What was the only lasting kingdom of Medieval Europe?

Respuesta :

kerryburleson107 kerryburleson107

04-03-2021

Answer:

it should be byzantine empire

Answer Link

jgeronimo jgeronimo

04-03-2021

Answer:

Kingdom of the Lombards.

Explanation:

Answer Link

Otras preguntas

Various politicians have often emphasized that unless we seal our Southern border, undocumented/illegal immigrants will enter and drive up crime rates.

the most dangerous type of skin cancer is __________.

Solve for all values of x in simplest form. |2x + 2) – 2 = 10

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

From the following symble, (18) 0-2 this atom contains 2 electrons?

Que motivo a los Vikingos a efectuar tan largas travesías?

Two construction workers combined income is $3025. If one earns $175 more than the other, find the monthly take home pay of each.

7x^3+4x Factor the expression completely. will give brainliest for first correct answer

I am named after the Russian scientist who organized the periodic table by atomic mass. Who am I?

How many moles of C5H120 would it take to generate 4.2 moles of CO2 from combustion? 2 CsH120 + 15 O2 → 10 CO2 + 12 H2O