Nerdz21 Nerdz21
  • 02-11-2016
  • Mathematics
contestada

list these from least to greaest 86% 47/50 0.89

Respuesta :

vanessa61
vanessa61 vanessa61
  • 02-11-2016
86%, 0.89, 17/50


This is because 0.89 as a percentage is 89% (because when you convert a decimal to a fraction, you jump two decimals to the right, and if you're making a percentage into a decimal, you jump two spaces to the left) and 47/50 is 90%. So, obviously 90% is over 89%, and 89% is over 86%.
Answer Link

Otras preguntas

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
Explain demand and supply of money.​
according to president obama, "it is not the fact war that sets hiroshima apart" what dose he mean by this?
Which of the following is a theme of the passage? A. Nature's relationship with people can be unkind. B. Isolation allows one to learn from mistakes. C. O
Which urban model is being MOST accurately depicted by the provided image? A photo of Rocinha Panorama is shown. Concentric Zone Model (wrong) Galactic City M
ILL GIVE BRAINLIEST IF ITS RIGHT
what is -8g=240 using one step equation
What type of cancers are associated with chemicals in cigarettes? SELECT ALL THAT APPLY a mouth cancer b eye cancer C throat cancer d lung cancer
I need help I dont understand ​
help me please Help me ​