BaconArmy BaconArmy
  • 02-02-2021
  • Mathematics
contestada

What is the measure of angle x? (Brainly + Bonus points for the best correct answer and explain)

What is the measure of angle x Brainly Bonus points for the best correct answer and explain class=

Respuesta :

Macoroon Macoroon
  • 02-02-2021

Answer: 76

Step-by-step explanation:

If a pair of parallel lines are cut by a line, the alternate angles are equal to each other. The angles 76 and x are alternate angles, so that means they are equal.

Answer Link

Otras preguntas

Solve the equation -10 + 3x + 5x = -56 ? ??
In which system of government would states function independently of each other?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?
A light bulb converts electrical energy into electromagnetic energy is true or false?
how do you know 8 thousandths is less than 1 hundredths
Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
four yardequal Blank feet